This study examined whether commercial milk thistle products (capsules, soft gel capsules, caplets, tablets, a tincture and teas) have an affect on the activity of CYP 3A4-mediated metabolism.

In vitro methods: All products were identified with a Nutraceutical Research Programme (NRP) number and vouchers were stored at the University of Ottawa. Dibenzylfluorescin (DBF) was obtained from BD GENTEST¹ (Woburn, USA). The other chemicals and solvents were all analytical grade.

Stock solutions were prepared unless stated otherwise at room temperature under reduced lighting conditions from the plant material within capsules. Capsules were extracted at a concentration of 100 mg/ml, vortexed for 1 min and centrifuged for 13 min at 13,000 rpm. All extracts were protected from light and were not kept for more than a day.

Milk thistle Content Analysis

Each sample was weighed (approximately 0.5 g) and extracted three times in 8 ml of 70 % ethanol using ultrasound for 5 min and then centrifuged at 1000 x g for 5 min. The supernatant was collected after each centrifugation and the final extract volume was adjusted to 25 ml. The extracts were filtered through a (0.22 : PTFE membrane) prior to injection into the High Performance Liquid Chromotography (HPLC) system. Samples were analyzed by HPLC using a 4 :m LiChrospher 100 RP-18, 75 x 4.6 mm analytical column and 5 :m LiChrospher 100 RP-18 guard column (E. Merck, Toronto, Canada) in a Varian Star HPLC system at 225 nm.

Cytochrome P450 Assay Procedure

Aliquots (5 :l) of stock solutions from the extracts were screened for their ability to inhibit 2C19, 3A4, 3A5 and 3A7 marker substrates using an in vitro fluorometric microtiter plate assay. The assays were performed in clear-bottom, opaque-welled microtiter plates (96 well, Corning Costar, model # CS00-3632, Corning, NY). Blank wells consisted of 70% ethanol or acetonitrile, deionized water, NADPH (ß-nicotinamide adenine dinucleotide phosphate, reduced form; Sigma Chemical Co., St-Louis, MO) solution, buffer solution (KH₂PO₄, pH 7.4 (0.5 M)), DBF and denatured enzyme (boiled). Control wells consisted of 70% ethanol or acetonitrile, deionized water, NADPH, buffer solution, DBF and 3A4 enzyme. Test wells contained milk thistle extract, deionized water, NADPH, buffer solution, DBF and enzyme. The control-test wells consisted of milk thistle extract, deionized water, NADPH, buffer solution, DBF and denatured enzyme. Control-blank wells contained milk thistle extract, deionized water, NADPH, buffer solution and enzyme. The enzyme was thawed in a 37°C sand bath. Solutions containing enzyme that had to be denatured were boiled for 15 min. All solutions were vortexed prior to addition to the wells except the solutions that required preservation of enzymatic activity. These were gently mixed and were sonicated for 2 sec before being added to the wells. The plates were agitated and incubated at 37°C in the plate reader and counted after 20 min.

The wells were prepared in triplicate to ensure the consistency of the results. The mean and coefficient of variation of each triplicate was calculated. Then, the difference between the test and the control-test was divided by the difference between the control and the control-blank. Each assay was repeated at least once. All assays were conducted under a gold fluorescent light to prevent product degradation.

RNA expression

A stock solution was prepared by aqueous extraction of ground material (60 mg /mL). The stock solution was centrifuged to remove solid matter and filter sterilized. The stock was added to the Caco-2 cell cultures in a serial 10-fold dilution with the final concentration of 1x treated cultures being equivalent to 6 mg/mL. Total RNA was extracted from the Caco-2 cells by using the QIAGEN RNeasy Mini kit with RNA stabilizer in accordance with manufacturer’s instructions. The concentration and purity of RNA were quantified spectrophotometrically. The sample was stored –70°C.

Reverse transcription reaction and PCR

Reverse transcription of RNA was done in a final volume of 50 :L by using Ready to go RT-PCR (Amersham Pharmacia Biotech). This was a one-step protocol for RT-PCR with incubation at 42°C for 15-30 min and 95°C for 5 min to inactivate the reverse transcriptase and to completely denature the template. The PCR reactions performed with initial denaturing at 95°C for 3 min then denaturing step at 95°C for 45 sec, annealing at 56°C for 45 sec and polymerization at 72°C for 90 sec followed by a final step at 72°C for 10 min repeated for a total of 40 cycles. The amplified fragments were detected by 1% agarose gel electrophoresis and staining with ethidium bromide (Sigma). Each band was analysed on a Image Station 440CF (Kodak Digital Science, Mandel Scientific Co., Guelph, ON). The specific gene expression was determined semi-quantitatively by calculating the ratio of density value from specific genes expressed in relation to the internal house keeping gene ß-actin (specific gene expression/ß-actin expression). The primers for each gene were according to following: ABCB1 sense, PCR product size: 250 bp 5’ GGAAGCCAATGCCTATGACT 3’: ABCB1 antisense, 5’ CGATGAGCTATC ACAATGGT 3’: ß-actin sense, PCR product size: 392 bp 5’ CATCCTCACCCTGAAGTACC 3’: ß-actin antisense 5’ GGTGAGGATCTTCATGAGGT 3’: CYP3A4 sense, PCR product size: 498 bp 5’ CAAGACCCCTTTGTGGAAAA 3’: CYP3A4 antisense, 5’ TCTGAGCGTTTCATTCACCA 3’.

All assays were performed under gold fluorescent lighting and samples were kept under reduced lighting conditions.

 

Results

Five products containing milk thistle in capsules were tested (Table 4.1.1). There were marked differences in the information provided on the product label and listed ingredient making it difficult to compare relative amounts of milk thistle in each product (Table 4.1.2). Daily dose of the capsules ranged from 2 to 3 units daily. Four of the products were reportedly standardized to 80% silymarin, one was standardized to 70% silymarin.

 

Table 4.1.1 Reference number to product:

 

NRP	Product	Company	Label	Price $C	EXP.	Store	Form	Received
150	Thisilyn (std MT extract)	Nature’s Way	200mg*100	46	Feb-04	RT	cap	18/07/02
151	Milk Thistle	Kare & Hope Inc.	460mg*90	22.49	Nov-04	RT	cap	18/07/02
152	Milk Thistle	Omega Alpha	500mg*60	22.99	Sep-06	RT	cap	18/07/02
153	Silymarin 80 (std MT extract)	Metagenics	70mg*90	21.4	Feb-03	RT	cap	18/07/02
154	Milk Thistle Plus	Genestra Brands	495mg*60	20.99	May-04	RT	cap	18/07/02

 

Table 4.1.2. Product information of the milk thistle sample examined in this study. Most products had sufficient label information on use and contraindications, form, unit weight, suggested dose, and other ingredients.

 

NRP	Product and ingredient list	Suggested Dose
150	200mg of Milk Thistle extract,140mg of 70% silymarin; 306mg capsules, exp. 02/04	One capsule * 3 (918mg)
151	460mg capsules, 80% silymarin, 210mg Milk Thistle standardized extract. 250mg Milk Thistle herb Powder; 456mg capsules, exp. 11/04	One capsule *3 (1380mg)
152	250mg Milk Thistle standardized extract (80% silymarin), Milk Thistle seed 250mg. Cellulose, stearic acid, microcrystaline cellulose and magnesium stearate. 460mg capsules, exp.09/06	One capsule *2 or 3 (920-1380mg)
153	Milk Thistle seed extract 70mg, standardized to 80%, 56mg silymarin; 420mg capsules, exp. 02/03	One capsule *3 (1200mg)
154	100mg Milk Thistle standardized extract (80%), 300mg Milk Thistle, 95mg silymarin; 416mg capsules, exp. 05/04	One capsule *3 (1248mg)

 

Each product was analysed to determine content (Table 4.1.3). Constituent analysis determined the total amount of the silymarins (SMN) present which include individual amounts of : taxifolin (TAN), taxifolin (TAX), silichristin (SCN), silidianin (SDN), silybin A (SBA), silybin B (SBB), and isosilybin (ISB). Although there were similarities in the amounts of the various constituents detected, analysis on the basis of total SMN/unit or total amount of SBA + SBB per gram revealed that there are marked differences in the products tested. Table 4.1.4 displays the inhibition of cytochrome P450’s by Milk Thistle 100mg/ml water extracts. Table 4.1.5 displays the inhibition of cytochrome P450’s by Milk Thistle 3 and 100 mg/ml ethanol extracts. Note 25 and 50 mg/ml extracts had values similar to the 100mg/ml extracts. Table 4.1.6 displays the total expected inhibitory activity of water extracts per capsule. Relative activity to NRP 150 is given in brackets. Finally, Table 4.1.7 displays the cost breakdown summary of each product relative to the amount of purported active ingredient.

 

Table 4.1.3. Constituent Analysis of the Silymarins (SMN), taxifolin (TAN), Taxifolin (TAX), silichristin (SCN), silidianin (SDN), silybin A (SBA), silybin B (SBB), isosilybin (ISB).

 

NRP	SMN/ unit exp. mg/mg	SMN found mg/unit	SMN found mg/g %	A+B mg/g	% AB	TAX %	SCN %	SDN %	SBA %	SBB %	ISB %
150	140/306 457	134	43595.2	220	50.7	3.3	23.6	5.3	20	30.7	17.3
151	168/456 368	123	27875.5	127	45.5	5.1	26.4	4.4	16.7	29	18.5
152	200/460 435	143	30870.8	173	55.9	2.4	22.7	4	21.9	34.3	14.9
153	56/402 139	41	10172.7	60	61	2.2	20.8	3.5	22.7	37.4	13.5
154	95/416 228	73	17878.1	103	57.5	2.6	21.4	4	22.2	35.8	13.8

 

Table 4.1.4.Inhibition of cytochrome P450’s by Milk Thistle 100mg/ml water extracts, n=1-2 replicates

 

NRP#	3A4	3A5	3A7	2C19
150	70.9±1.4	57.2	74.7±12.0	91.4
151	87.5±5.5	73.6	70.2±13.2	99.3
152	103.9±7.8	87.3	73.1±14.7	102.4
153	8.08±2.8	64.9	76.5±16.7	91.8
154	55.5±3.5	62	74.0±13.5	98.8

 

Table 4.1.5. Inhibition of cytochrome P450’s by Milk Thistle 3 and 100 mg/ml ethanol extracts, n=2 replicates. Note 25 and 50 mg/ml extracts had values similar to the 100mg/ml extracts.

 

NRP#	3A4	3A5	3A7
150	80.7 102.5	72.9 98.5	Nt. 96.5
151	82.4 98.4	78.1 95.2	Nt. 101.8
152	70.7 100.6	62.8 101.7	Nt. 101.5
153	58.3 100.3	48.7 93.8	Nt. 98.6
154	61.9 100.6	45.5 97.1	Nt. 101.4

 

Table 4.1.6. Total expected inhibitory activity of water extracts per capsule. Relative activity to NRP 150 is given in brackets.

 

NRP#	Weight	3A4	3A5	3A7	2C19
150	306 mg	217 (1)	175 (1)	228.6 (1)	279.7 (1)
151	456 mg	399 (1.8)	335.6 (1.9)	333.3 (1.5)	452.8 (1.6)
152	460 mg	478 (2.2)	401.6 (2.3)	336.3 (1.5)	471 (1.7)
153	402 mg	325 (1.5)	260.9 (1.5)	307.5 (1.3)	369 (1.3)
154	416 mg	231 (1.1)	258 (1.5)	307.8 (1.3)	411 (1.5)

Table 4.1.7. Cost breakdown summary of product relative to amount of purported active ingredient.

 

NRP	$C	Label	Unit cost	SMN mg/ unit	Cost/mg SMN/ unit
150	46	200mg*100	0.46	134	0.0034
151	22.49	460mg*90	0.25	123	0.002
152	22.99	500mg*60	0.383	143	0.0027
153	21.4	70mg*90	0.238	41	0.0058
154	20.99	495mg*60	0.35	73	0.0048

 

Discussion

Inter-individual variability can be further confounded by how the product is prepared and consumed. The results here show that the pharmacologically active constituents within these natural products are not only constituents which may elicit a systemic or pre-systemic effect on drug disposition. The potential risk of a specific product for affecting the safety and efficacy of conventional therapeutic products cannot be determined on the basis of in vitro analysis. Nor can the potential risk be extrapolated to related products until others products and multiple lots have been examined. Some products may contain highly active components which interact with absorption proteins and metabolic enzymes in the gastrointestinal tract and effect a pre-systemic response which mediates disposition of drugs and natural products taken subsequently.

The potential for the natural products examined in this study to affect drug disposition may increase if used in combination with one or more conventional therapeutic products or other natural products. Patients taking other medications or NHPs would be expected to be at a higher risk of experiencing a clinically significant event. Hence, it is necessary to consider the total xenobiotic load of NHPs and pharmaceuticals in order to better predict the potential for interactions. As with garlic² and St John’s wort³, as the duration of use of these milk thistle products is increased, the potential for an interaction would also be expected to increase.

With the increase in use of herbal medicinal preparations it is becoming increasingly important to elucidate potential adverse effects, including interactions between herbal and conventional drugs. Also, progress needs to be made by manufacturers in assuring their herbal products contain the levels of active ingredients indicated on the product label. This would lead to an increased consumer acceptance of potentially beneficial herbal medications.

 

Contributions to the in vitro study

Ed Mills conceptualized the study, provided funding, acquired the herbal materials and co-wrote the manuscript.

Brian Foster supervised the experiments and co-wrote the manuscript.

C. Drouin and J Livesey conducted the experiments.

J.Thor. Arnason provided expertise in interpreting results.

1. GENTEST. Methodology of a high throughput method for measuring cytochrome P-450 inhibition (version 2). Woburn: GENTEST Technical bulletin, GENTEST Corp. 1998.

2. Piscitelli SC, Burstein AH, Welden N, Gallicano KD, Falloon J. The effect of garlic supplements on the pharmacokinetics of saquinavir. Clin Infect Dis 2002;34:234-8.

3. Piscitelli SC, Burstein AH, Chaitt D, Alfaro RM, Falloon J. Indinavir concentrations and St John’s wort. Lancet 2000;355:547-8.